View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8050_low_18 (Length: 290)
Name: NF8050_low_18
Description: NF8050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8050_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 13 - 114
Target Start/End: Complemental strand, 906892 - 906791
Alignment:
| Q |
13 |
aatattaaagataaagtttaaaccgaaaatgatatggcaaaagttctcgagttcccaacactcactcttttattatacaaatttgaagatgagactcgtt |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
906892 |
aatattaaagataaagtttaaactgaaaatgatattgcaaaagttctcgagttcccaacactcactcttttattatacaaatttgaagatgagactagtt |
906793 |
T |
 |
| Q |
113 |
tt |
114 |
Q |
| |
|
|| |
|
|
| T |
906792 |
tt |
906791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 98 - 247
Target Start/End: Complemental strand, 906769 - 906626
Alignment:
| Q |
98 |
aagatgagactcgttttggaaggggtaagggtgtagaaggcaatcaccacttccaaattaacatttcaaaagaaaaattcacaaaacttgcaaaaatttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| | || ||| ||| || ||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
906769 |
aagatgagactcgttttggaaggggtaagggtgtagata--aattaacatttcaaaagaaaaattacaaaa----aattcacaaaacttgcaaaaatttc |
906676 |
T |
 |
| Q |
198 |
accaatattctgttaagcacatactgactggaagtgcttgacatagttgt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
906675 |
accaatattctgttaagcacatactgactggaagtgcttgacatagttgt |
906626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University