View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8051_high_2 (Length: 291)
Name: NF8051_high_2
Description: NF8051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8051_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 51 - 199
Target Start/End: Complemental strand, 5689776 - 5689624
Alignment:
| Q |
51 |
agtggagaaataataagtggtttgatg---gattttgtaatggagatttttctttttgcataatgcttggaatgagtagttgtttgaatatgacaaggnn |
147 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5689776 |
agtggagaaataataagtggtttgatgattgattttgtaatggagatttttctttttgcataatgcttggtatgagtagttgtttgaatatgacaaggaa |
5689677 |
T |
 |
| Q |
148 |
nnnnnntgatgcaaaagtaccttatggttgtcatcattg-ttttggaccataa |
199 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
5689676 |
aaaaaatgatgcaaaagtaccatgtggttgtcatcattgaatttggaccataa |
5689624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University