View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8052_low_1 (Length: 258)
Name: NF8052_low_1
Description: NF8052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8052_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 25609674 - 25609529
Alignment:
| Q |
18 |
ctcgttttgtaacaagtctaataaaaaacttttaaccttgattggtttactgaagaactatgtggcatcagcagataagtatgaacccccttctgaagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25609674 |
ctcgttttgtaacaagtctaataaaaaacttttaaccttcattggtttactgaagaactctgtggcatcagcagataagtatgaacccccttctgaagaa |
25609575 |
T |
|
| Q |
118 |
gtattgttgccttccggatctgcatagttcttctttccactattct |
163 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25609574 |
gtattgtcgccttccggatctgcatagttcttctttgcactattct |
25609529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University