View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8053_high_7 (Length: 306)
Name: NF8053_high_7
Description: NF8053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8053_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 17 - 296
Target Start/End: Complemental strand, 47619842 - 47619563
Alignment:
| Q |
17 |
actatcaatgtgtggaacaccaggagacatggcgtgggaaagaaggcgtcgacaaactcaacgtaggaggaatagcatgcacgattgcaacgacgaagat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619842 |
actatcaatgtgtggaacaccaggagacatggcgtgggaaagaaggcgtcgacaaactcaacgtaggaggaatagcatgcacgattgcaacgacgaagat |
47619743 |
T |
 |
| Q |
117 |
ctaaatgagcttagaggatgtattgaattaggatttggatttaatgaggaagatggacaaaagctttgcaatacattaccggctcttgatctatattttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619742 |
ctaaatgagcttagaggatgtattgaattaggatttggatttaatgaggaagatggacaaaagctttgcaatacattaccggctcttgatctatattttg |
47619643 |
T |
 |
| Q |
217 |
ccgttaaccggaacctgtctccaagtccggtatctacacctacaactcatcgcactactcacagccgttcatcttcatct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619642 |
ccgttaaccggaacctgtctccaagtccggtatctacacctacaactcatcgcactactcacagccgttcatcttcatct |
47619563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University