View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8053_low_13 (Length: 245)
Name: NF8053_low_13
Description: NF8053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8053_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 79 - 208
Target Start/End: Original strand, 23598358 - 23598487
Alignment:
| Q |
79 |
tccattgacttaggtttgtctttagtttgaaggatgttttagttgtagttcttgcctattttggcaggggtttattcaatttgctatacttttcaaatcc |
178 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23598358 |
tccattgactttggtttgtctttagtttgaaggatgttttagttgtagttcttgcctattttggcaggggtttattcagtttgctatacttttcaaatcc |
23598457 |
T |
|
| Q |
179 |
aaaattacctgcataaaatcaaaagagata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23598458 |
aaaattacctgcataaaatcaaaagagata |
23598487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 23598251 - 23598328
Alignment:
| Q |
1 |
atactagaaaaagattaaaaaatggctcaattgactttgttggttttggtttggcttttgaaactgtatcaggttggt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23598251 |
atactagaaaaagattaaaaaatggctcaattgactttgttggttttggtttggcttttgaaactgtatcaggttggt |
23598328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 78
Target Start/End: Original strand, 23598202 - 23598240
Alignment:
| Q |
40 |
ttggttttggtttggcttttgaaactgtatcaggttggt |
78 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
23598202 |
ttggttttggtttggcttttaaaactgtagcaggttggt |
23598240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University