View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8053_low_14 (Length: 230)
Name: NF8053_low_14
Description: NF8053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8053_low_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 46 - 230
Target Start/End: Complemental strand, 56165596 - 56165412
Alignment:
| Q |
46 |
tgcaatgtcatgcaagcacatatggaaaagatggttgagaagaagaaaggtttctttaaatggaagaaacttgcttttagtaaaagcattggtggcgaga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56165596 |
tgcaatgtcatgcaagcacatatggaaaagatggttgagaagaagaaaggtttctttaaatggaagaaacttgcttttagtaaaagcattggtggcgaga |
56165497 |
T |
|
| Q |
146 |
tggagaatgttgaacaacatgaagctgaaactgaatttcgatttggaaggcaaatcacaccaacagacttggtgtaaaccaatat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
56165496 |
tggagaatgttgaacaacatgaagctgaaactgaatttcgatttggaaggcaaaacacaccaacagacttggtgtaaaccaatat |
56165412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 46 - 199
Target Start/End: Complemental strand, 44263858 - 44263708
Alignment:
| Q |
46 |
tgcaatgtcatgcaagcacatatggaaaagatggttgagaagaagaaaggtttctttaaatggaagaaacttgcttttagtaaaagcattggtggcgaga |
145 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
44263858 |
tgcaatgtcatgcaagcacagatggacaagatggctgagaagaagaaaagtttcttcaaatggaagaaacttgcttttagtaaaagcat---cggagaga |
44263762 |
T |
|
| Q |
146 |
tggagaatgttgaacaacatgaagctgaaactgaatttcgatttggaaggcaaa |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44263761 |
tggagaatgttgaacaagatgaagctgaaactgaatttggatttggaaggcaaa |
44263708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 195 - 230
Target Start/End: Complemental strand, 44262911 - 44262876
Alignment:
| Q |
195 |
gcaaatcacaccaacagacttggtgtaaaccaatat |
230 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44262911 |
gcaaaacacaccaacagacttggtgtaaaccaatat |
44262876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University