View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8053_low_7 (Length: 377)
Name: NF8053_low_7
Description: NF8053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8053_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 17 - 358
Target Start/End: Complemental strand, 36463830 - 36463489
Alignment:
| Q |
17 |
atggtttccatcagaagccaattcaagcaatggaataagtctttgttgaacttcatcttcaagtgtctttgcaacaaagtctttgagagaccttgttgtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36463830 |
atggtttccatcagaagccaattcaagcaatggaataagtctttgttgaacttcatcttcaagtgtctttgcaacaaagtctttgagagaccttgttgtg |
36463731 |
T |
 |
| Q |
117 |
aattcgtggctgcctattttacgctgctttgaccacaactttccatccgcattgaatatgccgcaacctaaaaggtcacttagaatttcagtgaagggtt |
216 |
Q |
| |
|
||||| ||||| ||||||||||| || |||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
36463730 |
aattcatggctacctattttacgttgttttgaccataactttccatctacattgaatatgccgcaacctaaaaggtcactgagaatttctgtgaagggtt |
36463631 |
T |
 |
| Q |
217 |
ttcctttagggaagttagtgaaattggttttgagaatgtattcaacgttcagagggttggcggttatgatggttcggcgggcgccgaggcggttgatgag |
316 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||| ||||||||||| || ||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36463630 |
tacctttagggaagttggtgaaattggttttgaggatgtattcaacattgagaggattggcggttatgatggttcggcgtgcgccgaggcggttgatgag |
36463531 |
T |
 |
| Q |
317 |
gattgtttgagttggagattgggagagaaggtgagtgtagaa |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36463530 |
gattgtttgagttggagattgggagagaaggtgagtgtagaa |
36463489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University