View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8054_high_6 (Length: 237)
Name: NF8054_high_6
Description: NF8054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8054_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 28851709 - 28851492
Alignment:
| Q |
5 |
aaaaaatgtttatttcatccacatctccttgacactaacagttgtattacttatatcaaaatgcacttattcaaccaaaccaaaagagctttggtaaaaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28851709 |
aaaaaatgtttatttcatccacatctcctcaacattaacagttgtattattta-atcaaaacgcacttattcaaccaaaccaaaagagctttggaaaaaa |
28851611 |
T |
 |
| Q |
105 |
gagaaaatggctaaaatttcatgactagaaaagcttcattgtcatggaaggacttgtgcctcttgcttgcatgtgaactttcaggagaagaatttggata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28851610 |
gagaaaatggctaaaatttcatgactagaaaagcttcatcgtcatggaaggacttgtgcctcttgcttgcatgtgaactttcaggagaagaatttggata |
28851511 |
T |
 |
| Q |
205 |
taattcatcagttgttttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28851510 |
taattcatcagttgttttt |
28851492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University