View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8054_low_5 (Length: 366)
Name: NF8054_low_5
Description: NF8054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8054_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 345
Target Start/End: Original strand, 37057545 - 37057886
Alignment:
| Q |
1 |
gattgaatgatggatatgtatctaattcgacatgatgggatctaagatctacagtccgatgattgttgcggaggcgttgaagtggttaaactttgaacaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37057545 |
gattgaatgattgatatgtatctaattcgacatgatgggatctaagatctacggtccgatgattgttgcggaggcgttgaagtggttaaactttgaacaa |
37057644 |
T |
 |
| Q |
101 |
caactcattctcttgcgaaggggaatggtatacatgcaaacactcaaactaagtataaaatgcatcaaatatatacaagatttttagggtagaaaagcgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||| || |
|
|
| T |
37057645 |
caactcattctcttgcgaaggggaatggtatacatgcaaacactccaactaagtataaaatgcgtcaaatatatacaagatttttatggtagaaaagtgt |
37057744 |
T |
 |
| Q |
201 |
gcacctggatggagtctattggattaaggtttttggtctttctaactctaatccgaacaattgtccagggacacatgtgcagtacagattaaagatggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37057745 |
gcacctggatggagtctattggattaaggtttttggtctttctaactctaatccgaacaattgtccagggacacatgtgcag---agattaaagatggtt |
37057841 |
T |
 |
| Q |
301 |
tggaaggatccaatcctctgaaaaaatggatcttaacctggtcag |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37057842 |
tggaaggatccaatcctctgaaaaaatggatcttaacctggtcag |
37057886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University