View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8054_low_8 (Length: 237)

Name: NF8054_low_8
Description: NF8054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8054_low_8
NF8054_low_8
[»] chr8 (1 HSPs)
chr8 (5-223)||(28851492-28851709)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 28851709 - 28851492
Alignment:
5 aaaaaatgtttatttcatccacatctccttgacactaacagttgtattacttatatcaaaatgcacttattcaaccaaaccaaaagagctttggtaaaaa 104  Q
    |||||||||||||||||||||||||||||  ||| |||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| |||||    
28851709 aaaaaatgtttatttcatccacatctcctcaacattaacagttgtattattta-atcaaaacgcacttattcaaccaaaccaaaagagctttggaaaaaa 28851611  T
105 gagaaaatggctaaaatttcatgactagaaaagcttcattgtcatggaaggacttgtgcctcttgcttgcatgtgaactttcaggagaagaatttggata 204  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28851610 gagaaaatggctaaaatttcatgactagaaaagcttcatcgtcatggaaggacttgtgcctcttgcttgcatgtgaactttcaggagaagaatttggata 28851511  T
205 taattcatcagttgttttt 223  Q
    |||||||||||||||||||    
28851510 taattcatcagttgttttt 28851492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University