View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8054_low_9 (Length: 227)
Name: NF8054_low_9
Description: NF8054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8054_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 15 - 87
Target Start/End: Original strand, 48569018 - 48569090
Alignment:
| Q |
15 |
aacctgtgtggcattttccagagaaaccttatgaatcagaggaaaccatgcgtaaggtaaacattcattgtgg |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48569018 |
aacctgtgtggcattttccagagaaaccttatgaatcagaggaaaccatgcgtaaggtgaacattcattgtgg |
48569090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 146 - 206
Target Start/End: Original strand, 48569141 - 48569201
Alignment:
| Q |
146 |
gaaatcttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569141 |
gaaatcttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacct |
48569201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 10822265 - 10822202
Alignment:
| Q |
17 |
cctgtgtggcattttccagagaaaccttatgaatcagaggaaaccatgcgtaaggtaaacattc |
80 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
10822265 |
cctgtgtggcattttccagaaaaagtatatgaatcagaggaaactatgcgtaaggtgaacattc |
10822202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 36145131 - 36145194
Alignment:
| Q |
17 |
cctgtgtggcattttccagagaaaccttatgaatcagaggaaaccatgcgtaaggtaaacattc |
80 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
36145131 |
cctgtgtggcattttccagaaaaagtatatgaatcagaggataccatgcgtaaggtgaacattc |
36145194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 211
Target Start/End: Complemental strand, 10821937 - 10821878
Alignment:
| Q |
152 |
ttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacctatttt |
211 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||||||||| || ||||| |||||| |
|
|
| T |
10821937 |
ttgcagtgtgcagaatctgccttgaaatcagtcttaggagatctttcgaatacatatttt |
10821878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University