View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8055_low_7 (Length: 202)
Name: NF8055_low_7
Description: NF8055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8055_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 42161811 - 42161621
Alignment:
| Q |
1 |
tcgaaattcgattctttctcttccttttgtttctctaatatgtctcgttttatgaatatgttatccttcagttttgatgatgacaaagatggttttaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161811 |
tcgaaattcgattctttctcttccttttgtttctctaatatgtctcgttttatgaatatgttatccttcagttttgatgatgacaaagatggttttaatg |
42161712 |
T |
|
| Q |
101 |
ttctcactgaaccaacatcaacaacgttgttcttcgttggttcagcttgtggttgtggtggttttggtgactgggactcgtttttcttctt |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161711 |
ttctcactgaaccaacatcaacaactttgttcttcgttggttgagcttgtggttgtggtggttttggtgactgggactcgtttttcttctt |
42161621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University