View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8056_high_6 (Length: 240)
Name: NF8056_high_6
Description: NF8056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8056_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 46897623 - 46897420
Alignment:
| Q |
13 |
agaagaagttagtgaagttagcgataacattacaaacatgggtttagatcttcacgaggagtttaagttaaatgactgagccgctagtggaaggtaaata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46897623 |
agaagaagttagtgaagttagcgataacattacaaacatgggtttagatcttcacgaggagtgtaaattaaatgactgagccgctagtggaaggtaaata |
46897524 |
T |
|
| Q |
113 |
agaaactactatactcttagacaggtttggatgttgagtttgaagtaagtaaacctgacctgtgctaaaaaagttttttaactggtcgtgggttttcatc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46897523 |
agaaactactatactcttagacaggtttggatgttgagtttgaagtaagtaaacctgacctatgctaaaaaagttttttaactggtcgtgggttttcatc |
46897424 |
T |
|
| Q |
213 |
tgca |
216 |
Q |
| |
|
|||| |
|
|
| T |
46897423 |
tgca |
46897420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University