View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8056_low_6 (Length: 352)
Name: NF8056_low_6
Description: NF8056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8056_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 84 - 334
Target Start/End: Original strand, 6055371 - 6055621
Alignment:
| Q |
84 |
ataaaaactaccgtgatcgacggcgatcgcaactaactttaacttctccgatcaccagcggcgattcggatccatcggaatccgaaacatacccgcttaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6055371 |
ataaaaactaccgtgatcgacggcgatcgcaactaactttaacttctccgatcaccagcggcgattcggatccatcggaatccgaaacatacccgcttaa |
6055470 |
T |
 |
| Q |
184 |
ctctattcggatctttccacatgcttcgtgaaactttattgattttcctatccttgttctttttcggatatgcagatcctgctccgaaatgcactcgaaa |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6055471 |
ctctattcggatctttccacatgcttcgtgaaactttattgattttcctatccttgttctttttcggatatgcagatcctgctccgaaatgcactcgaaa |
6055570 |
T |
 |
| Q |
284 |
cagttccttcatcgatttcgaatccgatttcattatggttcaacatcaact |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6055571 |
cagttccttcatcgatttcgaatccgatttcattatggttcaacatcaact |
6055621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University