View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8057_low_13 (Length: 238)
Name: NF8057_low_13
Description: NF8057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8057_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 9105578 - 9105786
Alignment:
| Q |
12 |
atattattctctttgtgttgaggagctgatgaattacgaatgactttgctcaacctctttttgacaggttgagcattcttctcgctttgttgaggagttg |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9105578 |
atattcttctctttgtgttgaggagctgatgaattacgaatgactttgctcaacctctttttgacaggttgagcattcttctcgctttgttgaggagctg |
9105677 |
T |
|
| Q |
112 |
attgatcaccaatttgtctattagtcactctctttttggcaggttgagtattcttctctccgtgttgaggagttggtgaatcaccaatttgtctattcac |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9105678 |
attgatcaccaatttgtctattattcactctctttttggcaggttgagtattcttctctccgtgttgaggagttggtgaatcaccaatttgtctattcac |
9105777 |
T |
|
| Q |
212 |
cctcttttt |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
9105778 |
cctcttttt |
9105786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 66 - 166
Target Start/End: Original strand, 9105707 - 9105804
Alignment:
| Q |
66 |
ctctttttgacaggttgagcattcttctcgctttgttgaggagttgattgatcaccaatttgtctattagtcactctctttttggcaggttgagtattct |
165 |
Q |
| |
|
||||||||| ||||||||| ||||||||| | ||||||||||||| | |||||||||||||||||| ||| |||||||||||||| |||| ||||| |
|
|
| T |
9105707 |
ctctttttggcaggttgagtattcttctctccgtgttgaggagttggtgaatcaccaatttgtctatt---caccctctttttggcaggctgagcattct |
9105803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 9105778 - 9105834
Alignment:
| Q |
65 |
cctctttttgacaggttgagcattcttctcgctttgttgaggagttgattgatcacc |
121 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||| |||||| |||| ||||||| |
|
|
| T |
9105778 |
cctctttttggcaggctgagcattcttatcgctttgtggaggagctgatggatcacc |
9105834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 136 - 220
Target Start/End: Complemental strand, 41076267 - 41076183
Alignment:
| Q |
136 |
tcactctctttttggcaggttgagtattcttctctccgtgttgaggagttggtgaatcaccaatttgtctattcaccctcttttt |
220 |
Q |
| |
|
|||| |||||||||| ||| || ||||||||||| ||||||||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
41076267 |
tcaccctctttttggtaggctgcatattcttctctttgtgttgaggagctgatgaatcaccaatttgtctattgaccctcttttt |
41076183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 41076244 - 41076135
Alignment:
| Q |
12 |
atattattctctttgtgttgaggagctgatgaattacgaatgactttgctcaacctctttttgacaggttgagcattcttctcgctttgttgaggagttg |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || ||| | | | | |||||||||| || |||||||| |||| ||||||||| |||||| || |
|
|
| T |
41076244 |
atattcttctctttgtgttgaggagctgatgaatcaccaatttgtctattgaccctctttttggcaagttgagcaatcttatcgctttgtggaggagctg |
41076145 |
T |
|
| Q |
112 |
attgatcacc |
121 |
Q |
| |
|
|| ||||||| |
|
|
| T |
41076144 |
atggatcacc |
41076135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University