View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8057_low_8 (Length: 355)
Name: NF8057_low_8
Description: NF8057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8057_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 13 - 345
Target Start/End: Original strand, 6878575 - 6878907
Alignment:
| Q |
13 |
cgcccgcgccagttggagaggacgcacgtgaggccttatacgagatgctaccgggcagattaagaatgaaggtaaaggcgaagctaaggggacggtgggc |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878575 |
cgcccgcgacagttggagaggacgcacgtgaggccttatacgagatgctaccgggaagattaagaatgaaggtaaaggcgaagctaaggggacggtgggc |
6878674 |
T |
 |
| Q |
113 |
gaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatggctgtctccggtggcgcatgac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878675 |
gaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatggctgtctccggtggcgcatgac |
6878774 |
T |
 |
| Q |
213 |
acagtccggtggcatggggaaaggcatttggagaagacaagatttgagacaaagcctacggcaatgcttctgcagacattgcattactctgatttggaga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878775 |
acagtccggtggcatggggaaaggcatttggagaagacaagattcgagacaaagcctacggcaatgcttctgcagacattgcattactctgatttggaga |
6878874 |
T |
 |
| Q |
313 |
aggcagagactgccatagtggaagtgttggttg |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6878875 |
aggcagagactgccatagtggaagtgttggttg |
6878907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University