View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8057_low_9 (Length: 317)
Name: NF8057_low_9
Description: NF8057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8057_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 300
Target Start/End: Complemental strand, 5345385 - 5345101
Alignment:
| Q |
16 |
atcactttacagggtaaagattgccctcgtttataaacatttattcaggtcatctcttaaccgatgtgagacattaacgaaccttgatgtgatgtagcaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5345385 |
atcactttacagggtaaagattgccctcgtttataaacatttattcaggtcatctcttaaccgatgtgaaacattaacgaaccttgatgtgatgtagcaa |
5345286 |
T |
 |
| Q |
116 |
ctacacttaatccttggttcataacaagattatgaaaaaggcttctctattataattttgacaacaatgtgaagatttttatggtccttgctgcatcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5345285 |
ctacacttaatccttggttcataacaagattatgaaaaaggcttctctattataattttgacaacaatgtgaagatttttatggtccttgctgcatcata |
5345186 |
T |
 |
| Q |
216 |
ttgttacagctgtaattgcagctgtatcatattggattgcaattttctgcaatttcatttgaaaacatagttatgagttgattct |
300 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5345185 |
ttgttacagctgtaattgcagttgtatcatattggattgcaattttctgcaatttcatttgaaaacatagttatgagttgattct |
5345101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 33702283 - 33702327
Alignment:
| Q |
46 |
ttataaacatttattcaggtcatctcttaaccgatgtgagacatt |
90 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
33702283 |
ttataaacatttattcatgtcatctctcaaccgatgtgagacatt |
33702327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University