View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_high_20 (Length: 242)
Name: NF8058_high_20
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_high_20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 49950537 - 49950296
Alignment:
| Q |
1 |
atgttagtttttcttttattaagannnnnnngtccatacttagtgaggacttcgggattttgttcgttcggtttcactataatgctacacttcctccaag |
100 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49950537 |
atgttaatttttcttttattaagaattttttgtctatacttagtgaggacttcgggattttgttcgttcggtttcactataatgctacacttcctccaag |
49950438 |
T |
|
| Q |
101 |
tttcccttcctacttcctcaccctaattcctaaaatcgcatcaccttttcggttaggattttagacatatctgactggtaggttattgcacaaattgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49950437 |
tttcccttcctacttcctcaccctaattcctaaaatcgcatcaccttttcggttaggattttagacatatctaactggtaggttattgcacaaattgctt |
49950338 |
T |
|
| Q |
201 |
gccaaaattctagctgagtagttcgcaaatgttatcatttgt |
242 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49950337 |
gccagaattctagctgagtggttcgcaaatgttatcatttgt |
49950296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University