View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_high_25 (Length: 229)
Name: NF8058_high_25
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 5806753 - 5806557
Alignment:
| Q |
15 |
aagaaggtgtggaattgagaaagaaacagttactactcagtcagatcggcataccatctgctcaaagaagagtcacaaagaggaatagctgaatcatcag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
5806753 |
aagaaggtgtggaattgagaaagaaacagttactactcagtcagatcggcataccatctgctcaaagaggagtcacaaagaggaatagctgaaccatcag |
5806654 |
T |
 |
| Q |
115 |
tagctgggaacaacagtatttggaaggatatctggaagattcgagcaccacaaaggattaagaatttcatgtggagaatttccaaacatattcttcc |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5806653 |
tagctgggaacaacggtatttggaaggatatctggaagattcgagcaccacaaaggattaagaatttcatgtggagagtttccaaacatattcttcc |
5806557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University