View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_high_3 (Length: 466)
Name: NF8058_high_3
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 374; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 6 - 449
Target Start/End: Original strand, 20174064 - 20174504
Alignment:
| Q |
6 |
tgtttatccaacctatgccctgctgtatgtcggggccaatttctttttatattagctgtgtgcaaggcttgtgtaactctatactgttgaaaattcttta |
105 |
Q |
| |
|
||||||| ||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20174064 |
tgtttattcaaactatgcctagatgtatgtcggggccaatttctttttatattagctgtgtgcaaggcttgtgtaactctgtactgttgaaaattcttta |
20174163 |
T |
|
| Q |
106 |
ttaatttggaaagtaaacaaggtttcctaactgattgtttaggctccatgccatttatcatcacatacataaattcactatatgttatttcatattccat |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
20174164 |
ttaatttggaaagaaaacaaggtttcctaactgattgtttaggctccatgccatttatcatcacatacataaattaactatatgttatttcattttccat |
20174263 |
T |
|
| Q |
206 |
tgtcaaaagttgaagttgcttttcatatgatgtatcttgtttttatatctgcagcttttaaaagagtatcccagttggaaggcataattccagcagcttt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20174264 |
ggtcaaaagttgaagttgcttttcatatgatgtatcttgtttttatatctgcagcttttaaaagagtatcccagttggaaggcataattc---cagcttt |
20174360 |
T |
|
| Q |
306 |
ggaaacatcacatgctcttgcttatttagtgaaactctgccctacccttccaaatgaaacaaaggttgtggttaactgcagtggcagaggggataaggat |
405 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20174361 |
ggaaacatcacatgctcttgcttatttagagaaactctgccctacccttccaaatggaactaaggttgtggttaactgcagtggcagaggggataaggat |
20174460 |
T |
|
| Q |
406 |
gttcaaactgctatgaaatacttgaaaatttgaacgtacatgat |
449 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20174461 |
gttcaaactgctatgaaatacttgaaaatttgaaagtacatgat |
20174504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 349 - 415
Target Start/End: Complemental strand, 18402703 - 18402637
Alignment:
| Q |
349 |
acccttccaaatgaaacaaaggttgtggttaactgcagtggcagaggggataaggatgttcaaactg |
415 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
18402703 |
acccttcctaatgggacaaaggtcgtggttaacttcagtggccgaggtgataaggatgttcaaactg |
18402637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University