View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_high_8 (Length: 340)
Name: NF8058_high_8
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 19 - 324
Target Start/End: Complemental strand, 38959801 - 38959496
Alignment:
| Q |
19 |
ccggattgtccttgcagtattcctcgagagggtccgacgtctttttcttatcccttgcatggcttgccgctgcactcaattcctccacctcatcccacgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38959801 |
ccggattgtccttgcagtattcctcgagagggtccgacgtctttttcttatcccttgcatggcttgccgctgcactcaattcctccacctcatcccacgc |
38959702 |
T |
|
| Q |
119 |
tgccacacattcaccgctagtggcgtctcctgcacacgcctcttccgcactctttatgctctcttccaccttcccggttatgtccggtgatgcttgcact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38959701 |
cgccacacattcaccgctagtggcgtctcctgcacacgcctcttccgcactctttatgctctcttccaccttcccggttatgtccggtgatgcttgcact |
38959602 |
T |
|
| Q |
219 |
ggtcgaatgcttaccatcctaccggaactgactgcaccggtccatctttggttgagcatgaacaccggtccggacctgatggcctgagacttttgaagag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38959601 |
ggtcgaatgcttaccatcctaccggaactgactgcaccggtccatctttggttgagcatgaacaccggtccggacctgatggcctgagacttttgaagag |
38959502 |
T |
|
| Q |
319 |
actctg |
324 |
Q |
| |
|
|||||| |
|
|
| T |
38959501 |
actctg |
38959496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University