View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_low_14 (Length: 329)
Name: NF8058_low_14
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 309
Target Start/End: Original strand, 8375700 - 8375990
Alignment:
| Q |
19 |
cttgctgcaaaagtacttgcaaccggcgtctatattgcttgcaactcaggactgttttgtgcgaccgggacattacgggtagcaacaagtgattcaacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
8375700 |
cttgctgcaaaagtacttgcaaccggtgtctatattgcttgcaactcgggactgttttgtgcgaccgtgacattaggggtagcaacaagtgattcaacaa |
8375799 |
T |
 |
| Q |
119 |
tatgttcttcttttgttgcagttgctgaatcaatagcttcaaatgcattagaagaaccaacaccagaagaatttcctttaataggcaccaaatctagctt |
218 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
8375800 |
tatgctcttcttttgttgcagttgccgaatcaatagcttcaaatgcattagaagaaccaacaccaaaagaattttctttaataggcaccaaatctagctt |
8375899 |
T |
 |
| Q |
219 |
actagttggtatttgcttcttgccctttatagcattttccttagatacggttctttctttctgagggtacaactaatggcaaaccgtaaca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8375900 |
actagttggtatttgcttcttgccctttatagcatttttcttagatacggttctttctttctgagggtacaactaatggcaaaccgtaaca |
8375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 261
Target Start/End: Original strand, 18145631 - 18145664
Alignment:
| Q |
228 |
tatttgcttcttgccctttatagcattttcctta |
261 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
18145631 |
tatttgcttcttgccctttataacattttcctta |
18145664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University