View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_low_15 (Length: 319)
Name: NF8058_low_15
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 122 - 300
Target Start/End: Original strand, 9048509 - 9048687
Alignment:
| Q |
122 |
cttggaagggttcaagtcacactcctttattaatattcnnnnnnnagcagcaaagaaagatttattaatatataagattaaaatatgatctacacaacaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9048509 |
cttggaagggttcaagtcacactcctttattaatattctttttttagcagcaaagaaagatttattaatatataagattaaaatatgatctacacaacaa |
9048608 |
T |
|
| Q |
222 |
agccctagttttttcttatgnnnnnnnnnncttcatgattttgtcgtccgagtgcggcgtttcttgtttgtcgtcttgt |
300 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9048609 |
agccctagttttttcttatgttttttttttcttcatgattttttcgtctgagtgcggcgtttcttgtttgtcgtcttgt |
9048687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 47
Target Start/End: Original strand, 9048391 - 9048434
Alignment:
| Q |
4 |
cttttggattatttttcctggtgtgcttcatgatactagagttc |
47 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9048391 |
cttttggattattttttctggtgtgcttcatgatactagagttc |
9048434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University