View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_low_17 (Length: 301)
Name: NF8058_low_17
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 74 - 264
Target Start/End: Original strand, 1603833 - 1604023
Alignment:
| Q |
74 |
ggtatgacggagaaaccgacacgtggcatggaaatattgttcgtggttgggaggtgggtgtttaagatccgatcagttactgtatttctattggttcaca |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1603833 |
ggtatgacggagaaaccgacacgtggcatggaaatattgttcgtggttgggaggtgagtgtttaagatccgatcagttactgtatttctattggtccaca |
1603932 |
T |
 |
| Q |
174 |
atcagttttgcttttagggactgacacgtgtccggttgcatttagttctaccctacgcacgtgcctaaccaatatttctggtttgtgttgc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1603933 |
atcagttttgcttttagggactgacacgtgtccggttgcatttagttctaccctacgcacgtgcctaaccaatatttctggtttgtgttgc |
1604023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University