View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8058_low_20 (Length: 274)

Name: NF8058_low_20
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8058_low_20
NF8058_low_20
[»] chr8 (1 HSPs)
chr8 (8-255)||(42568499-42568740)


Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 8 - 255
Target Start/End: Original strand, 42568499 - 42568740
Alignment:
8 cgaagaatattacgatacagaaaactattgtataagataaacaattaaaatgaaaaatccagcatacatgtaaggtgagactgtgaagagtacaaggcaa 107  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42568499 cgaagaaaattacgatacagaaaactattgtataagataaacaattaaaatgaaaaatccagcatacatgtaaggtgagactgtgaagagtacaaggcaa 42568598  T
108 cttggagggaagattggaatagtttggtacttggacatccccatctttcttcaaagatgctgcaacctgaaacaaaaacaaaatgaatgtaattataatt 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||    
42568599 cttggagggaagattggaatagtttggtacttggacatccccatctttcttcaaagatgctgcaacctgaaacaaaaacaaaatgaatg------taatt 42568692  T
208 ataattataatacggccatgtttggataaacaacttaatcaaacactt 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
42568693 ataattataatacggccatgtttggataaacaacttaatcaaacactt 42568740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University