View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_low_24 (Length: 248)
Name: NF8058_low_24
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 50123160 - 50122941
Alignment:
| Q |
19 |
agtttgacaaagactaataattgatcaaaaaattagtaacttattattttacaaatttaaaaatatttttggatatacgtg----tgacattaattaaca |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50123160 |
agtttaacaaagactaataattgatcaaaaaattagcaacttattattttacaaatttaaaaatatttttggatatacgtgcaagtgacattaattaaca |
50123061 |
T |
 |
| Q |
115 |
ttattagttctatttataatccatggatgagaagtcccaaaaatagtagtcaaaggctgttactcactccaaagtgagctatggtttttctaaggcaatt |
214 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50123060 |
tta---gttctatttataatccatgcatgagaagtcccaaaaatagtagtcaaaggctgttactcactccaaagtgagctatggtttttctaaggcaatt |
50122964 |
T |
 |
| Q |
215 |
acttgctttcactctctcttctt |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50122963 |
acttgctttcactctctcttctt |
50122941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University