View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_low_27 (Length: 239)
Name: NF8058_low_27
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 13411403 - 13411610
Alignment:
| Q |
19 |
caaaaacattgtcttcaacacctaaagaaccatttggaaatccttgattatgttgagtttgataatttatctgattttgagatccataagagtaatcatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13411403 |
caaaaacattgtcttcaacacctaaagaaccatttggaaatccttgattatgttgagtttgataatttatctgattttgagatccataagagtaatcatt |
13411502 |
T |
 |
| Q |
119 |
gtattgtattccatgtgaaaaagggtccttttcttcttgtttcactgagaaagattctgaattagtaaacatggtttccatttctgaacttgtagaggta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13411503 |
gtattgtattccatgtgaaaaagggtccttttcttcttgtttcactgagaaagattctgaattagtaaacattgtttccatttctgaacttgtagaggta |
13411602 |
T |
 |
| Q |
219 |
gaataatg |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
13411603 |
gaataatg |
13411610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University