View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_low_29 (Length: 236)
Name: NF8058_low_29
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 10652552 - 10652768
Alignment:
| Q |
17 |
atatatatacataccctggagctgaaccatcaaggtaagatggtctaggctggccaggcatccaatcagaagtcatggtgaatctagaa---gcatttgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10652552 |
atatatatacataccctggagctgaaccatcaaggtaagatggtctaggctggccaggcatccaatcagaagtcatggtgaatctagaagaagcatttgt |
10652651 |
T |
 |
| Q |
114 |
agaagcagtacaaggaagtggaactgaagttgaaaatcttgattttgaggaagaaagaagtgatggaaatgctgagataccagaactcatcaatgtgtta |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10652652 |
agaagcagtacaaggaagtggaagtgaagttgaaaatcttgattttgaggaagaaagaagtgatggaaatgctgagatagcagaactcatcaatgtgtta |
10652751 |
T |
 |
| Q |
214 |
caagccattcttctcac |
230 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
10652752 |
caagccattcttgtcac |
10652768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University