View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8058_low_33 (Length: 218)
Name: NF8058_low_33
Description: NF8058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8058_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 128 - 206
Target Start/End: Original strand, 8272423 - 8272501
Alignment:
| Q |
128 |
caaaatcatcgtgatattgtagaagcacaagttgtagctttgcatttgtcgcacctttgatgtgctcttaaacacgaaa |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8272423 |
caaaatcaccgtgatattgtagaagcacaagttgtagctttgcatttgtcgcacctttgatgtgctcttaaacatgaaa |
8272501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 8271926 - 8272005
Alignment:
| Q |
1 |
ccactattacaacaagaatggactccatagttgaaaattgattgtgccctagtaaagccactgcaaatttatcattgttg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8271926 |
ccactattacaacaagaatggactccattgttgaaaattgattgtgctctagcaaagccactgcaaatttatcattgttg |
8272005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University