View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8059_high_11 (Length: 223)

Name: NF8059_high_11
Description: NF8059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8059_high_11
NF8059_high_11
[»] chr7 (1 HSPs)
chr7 (47-208)||(47127729-47127890)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 47 - 208
Target Start/End: Complemental strand, 47127890 - 47127729
Alignment:
47 gtcgatatgatggaacctatactgtaatagtgattaagatttgaatcaaactaaaatatataggatgaatgagattgacaataccgtcaactgcgtcttg 146  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||    
47127890 gtcgatatgatggaacctatactgtaatagtgattaagatttgaatcaaactaaaatatatagggtgaatgagattgacaataccgtcaactgcatcttg 47127791  T
147 tgaggtaggtgtcttagagttatgatcgatccaatactgcaatcgttcatcggctatctctg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
47127790 tgaggtaggtgtcttagagttatgatcgatccaatactgcaatcgctcatcggctatctctg 47127729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University