View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8059_high_11 (Length: 223)
Name: NF8059_high_11
Description: NF8059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8059_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 47 - 208
Target Start/End: Complemental strand, 47127890 - 47127729
Alignment:
| Q |
47 |
gtcgatatgatggaacctatactgtaatagtgattaagatttgaatcaaactaaaatatataggatgaatgagattgacaataccgtcaactgcgtcttg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47127890 |
gtcgatatgatggaacctatactgtaatagtgattaagatttgaatcaaactaaaatatatagggtgaatgagattgacaataccgtcaactgcatcttg |
47127791 |
T |
 |
| Q |
147 |
tgaggtaggtgtcttagagttatgatcgatccaatactgcaatcgttcatcggctatctctg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47127790 |
tgaggtaggtgtcttagagttatgatcgatccaatactgcaatcgctcatcggctatctctg |
47127729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University