View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8059_high_4 (Length: 350)
Name: NF8059_high_4
Description: NF8059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8059_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 38902843 - 38902659
Alignment:
| Q |
18 |
acaactgcagtaggcaagccccttaaacttggttgcttcctctgttccactgcaatcaagtaacaacattacattaattaaattggggaaattgaaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38902843 |
acaactgcagtaggcaagccccttaaacttggttgcttcctctgttccactgcaatcaggtaacaacattacattaattaaattggggaaattgaaattt |
38902744 |
T |
 |
| Q |
118 |
acagtgccgaaattgcgttgtaaagcatggaaaagagtgattgtgaaaccctaggaaccagaagagaatgcaaataaaatggttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38902743 |
acagtgccgaaattgcgttgtaaagcacggaaaagagtgattgtgaaaccctaggaaccagaagagaatgcaaataaaatggttt |
38902659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 219 - 278
Target Start/End: Complemental strand, 38902634 - 38902575
Alignment:
| Q |
219 |
atggaaccttgaacgtagaagcagtccatatcaacgtgagcaatgactcttccatcacaa |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38902634 |
atggaaccttgaacgtagaagcagtccatatcaacgtgagcaatgactcttccatcacaa |
38902575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University