View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8059_low_11 (Length: 236)
Name: NF8059_low_11
Description: NF8059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8059_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 6338078 - 6337872
Alignment:
| Q |
16 |
tgtgttcagtatcagttgattgttacttgtagaatgattggcttatttttatatttaaatctgttatttcatttttt-cttctccgtctcacactctcac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6338078 |
tgtgttcagtatcagttgattgttacttgtagaatgattggcttatttttatatttaaatctgttatttcatttttttcttctccgtctcacactctcac |
6337979 |
T |
|
| Q |
115 |
tccttcttatttgatggctgcaggcaagcttttgcatctgcatcggctgataatattaaaaagttcacccttccagaatgaaattttcgtcacaatatgg |
214 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6337978 |
tccttcttatttgttggctgcatgcaagcttttgcatctgcatcggctgataatattaaaaagttcacccttccagaatgaaattttcgtcacaatatgg |
6337879 |
T |
|
| Q |
215 |
tgtgatt |
221 |
Q |
| |
|
||||||| |
|
|
| T |
6337878 |
tgtgatt |
6337872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 118 - 219
Target Start/End: Complemental strand, 14192587 - 14192486
Alignment:
| Q |
118 |
ttcttatttgatggctgcaggcaagcttttgcatctgcatcggctgataatattaaaaagttcacccttccagaatgaaattttcgtcacaatatggtgt |
217 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || || | ||| ||||||||||| ||| |
|
|
| T |
14192587 |
ttcttctttgttggctgcaggcaagcttttgcatctgcatcagctgataatattaaaaagttcacccttccaaaaggagaattttgtcacaatatgctgt |
14192488 |
T |
|
| Q |
218 |
ga |
219 |
Q |
| |
|
|| |
|
|
| T |
14192487 |
ga |
14192486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 54
Target Start/End: Complemental strand, 14192703 - 14192665
Alignment:
| Q |
16 |
tgtgttcagtatcagttgattgttacttgtagaatgatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
14192703 |
tgtgttcaatatcagttgattgttacttgtagaacgatt |
14192665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University