View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8060_low_6 (Length: 305)
Name: NF8060_low_6
Description: NF8060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8060_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 13 - 183
Target Start/End: Original strand, 3806541 - 3806711
Alignment:
| Q |
13 |
aatatcaatacttatgtagaacaatcacaaccacatttagaataatgaatatgaatgtgaagtgggttttggctcaacttttctttcataatcactttga |
112 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3806541 |
aatatcaatacttgtgtagaataatgacaaccacatttagaataatgaatatgaatgtgaagtgggttttgcctcaacttttctttcataatcactttga |
3806640 |
T |
 |
| Q |
113 |
atcggaaataagagggagcgtacgttacttttgcaaatgtagtttgcaaaacgaattcctcgcagactata |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3806641 |
atcggaaataagagggagcgtacgttacttttgcaaatgtagtttgcaaaacgaattcctcgcagactata |
3806711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 288
Target Start/End: Original strand, 3806777 - 3806816
Alignment:
| Q |
249 |
attaaataatttagtgtttagaaattcatcctctttaatg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3806777 |
attaaataatttagtgtttagaaattcaacctctttaatg |
3806816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University