View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_high_25 (Length: 405)
Name: NF8061_high_25
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 56442811 - 56442989
Alignment:
| Q |
17 |
actacttctttttctgtaataataatcagaacatgaagaagatgaagatttgcgatgagacggaaacgacaatgagcagcagcatctcactcctatcgct |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56442811 |
actacttcttcttctgtaataataatcagagcatgaagaagatgaagatttgcgatgagacggaaacgacaatgagcagcagcacctcactcctatcgct |
56442910 |
T |
|
| Q |
117 |
gctgctgccatcacccctcactccttgccacgttgcagatttacttggattggattggattggattcatgcattgcatacttca |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
56442911 |
actgctgccatcacccctcactctttgccacgttgcaaatttac-----ttggattggattggattcatgcattgcatacttca |
56442989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University