View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_high_30 (Length: 370)
Name: NF8061_high_30
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_high_30 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 12 - 370
Target Start/End: Complemental strand, 29288673 - 29288315
Alignment:
| Q |
12 |
acattattcttgtaagctgggacaatttgcatgctggccattctgatttatttggttgatcaatatgtttttggttggtccttatggatgtatctccaag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29288673 |
acattattcttgtaagctgggacaatttgcatgttggccattctgatttatttggttgatcaatatgtttttggttggtccttatggatgtatctccaag |
29288574 |
T |
 |
| Q |
112 |
cccttatataaagtctttatatcatcatttcaacatattttgccttatatggatcatggacggtttgtctcataaaattcattagattctcttaaaaaga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29288573 |
cccttatataaagtctttatatcatcatttcaacatattttgccttatatggatcatggacggtttgtctcataaaattcattagattctcttaaaaaga |
29288474 |
T |
 |
| Q |
212 |
aacctttcccagcattctctctttttctttatctttacatttttcctttatgatatgaggttatgttgcctttagagtcttatcannnnnnnnngaggga |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29288473 |
aacctttcccagcattctctctttttctttatctttacatttttcctttatgatatgaggttatgttgcctttagagtcttatcatttttttttgaggga |
29288374 |
T |
 |
| Q |
312 |
agtcttatcatttcttttaaaaagagattaataaggcttaaactttttgaaaagtcaat |
370 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29288373 |
agtcttatcatttcttttaaaaagagataaataaggcttaaactttttgaaaagtcaat |
29288315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University