View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_high_38 (Length: 338)
Name: NF8061_high_38
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 320
Target Start/End: Complemental strand, 15349635 - 15349537
Alignment:
| Q |
222 |
gggtacaaggaatgcggttttggttcgaattcaagaccgactggtttatggaaattatggtggtaagagagacaaattaatgaaccaccgtcactttac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15349635 |
gggtacaaggaatgcggttttggttcgaattcaagaccgactggtttatggaaattatggtggtaagagaaacaaattaatgaaccaccgtcactttac |
15349537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 15349852 - 15349696
Alignment:
| Q |
1 |
tactagcagtatcggtgtatccttatctatgtcgtgtttgatgtctgtattaatttaaatagaatcatctcannnnnnnnngaagatattaatccttgta |
100 |
Q |
| |
|
||||| |||||||| || || || ||| ||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15349852 |
tactaacagtatcgacgtgtcattgtctgtgtcgtgttcggtgtctgtattaatttaaatagaatcatctcatatttttttgaagatattaatccttgta |
15349753 |
T |
 |
| Q |
101 |
gaattttgatttaattcactttggagtatttgatctgaattatattagaattatatg |
157 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15349752 |
gaattttgatttaattcacttttgagtatttgatctgaattatattagaattatatg |
15349696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University