View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_high_59 (Length: 251)
Name: NF8061_high_59
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_high_59 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 251
Target Start/End: Complemental strand, 18575420 - 18575177
Alignment:
| Q |
7 |
tcgaagaatatgataaattacgattcgaatttcaacacacgataaactagtatttgaatctttgttgaaagagatgttcatatttagagtccgacaaatt |
106 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
18575420 |
tcgaacaacatgataaattacgattcgaatttcaacacacgataaactattatttgaatctttgttgaaagagatgttcatatttagagtcagacaaact |
18575321 |
T |
|
| Q |
107 |
gttaagtaccggaccctttgaataggattttctcgggtaggagtagtattctcctaccatagnnnnnnnnnncaactccaatacatgtgttaaagctctc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18575320 |
gttaagtaccggaccctttgaataggatttt-tcgggtaggagtagtattctcctaccatagaaaaaaaaaacaactccaatacatgtgttaaagctctc |
18575222 |
T |
|
| Q |
207 |
cttaagagtcccatgtttggaaattgacttaattcatgttgctat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18575221 |
cttaagagtcccatgtttggaaattgacttaattcatgttgctat |
18575177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University