View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8061_high_77 (Length: 208)

Name: NF8061_high_77
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8061_high_77
NF8061_high_77
[»] chr7 (1 HSPs)
chr7 (14-108)||(27681881-27681975)


Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 14 - 108
Target Start/End: Complemental strand, 27681975 - 27681881
Alignment:
14 aagaatattatgtgaagctaagtcactccgtgctttatattaaagatatgtgtcttcttttacaactcatggaatattaatttaggtcaaatacc 108  Q
    ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
27681975 aagaaaattatgtgaagctaagttactccgtgctttatattaaagatatgtgtcttcttttacaactcatgaaatattaatttaggtcaaatacc 27681881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University