View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_high_77 (Length: 208)
Name: NF8061_high_77
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_high_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 14 - 108
Target Start/End: Complemental strand, 27681975 - 27681881
Alignment:
| Q |
14 |
aagaatattatgtgaagctaagtcactccgtgctttatattaaagatatgtgtcttcttttacaactcatggaatattaatttaggtcaaatacc |
108 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27681975 |
aagaaaattatgtgaagctaagttactccgtgctttatattaaagatatgtgtcttcttttacaactcatgaaatattaatttaggtcaaatacc |
27681881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University