View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_25 (Length: 423)
Name: NF8061_low_25
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 160 - 407
Target Start/End: Complemental strand, 50686198 - 50685951
Alignment:
| Q |
160 |
gtagggaagacgcaattgattaatcattttcgagttaatgatagttggtacctggttgatttgcctggatatgggtatgtatggttttaaggtttaacct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50686198 |
gtagggaagacgcaattgattaatcattttcgagttaatgatagttggtacctggttgatttgcctggatatgggtatgtatggttttaaggtttaacct |
50686099 |
T |
|
| Q |
260 |
tacaaagcaatcctgttttatgttacaaatttggggattaacattggaaatagcgaccaatgtatttgatacaaacatgttagtatggtttgcgaatatt |
359 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50686098 |
tacaaagcaatcttgttttatgttacaaatttggggattaacattggaaatagcgaccaatgtatttgatacaaacatgttagtatggtttgcgaatatt |
50685999 |
T |
|
| Q |
360 |
gtttgtgaattttgagtgtcaaacatcataacagtacgattccattat |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50685998 |
gtttgtgaattttgagtgtcaaacatcataacagtacgattccattat |
50685951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 19 - 89
Target Start/End: Complemental strand, 50686343 - 50686273
Alignment:
| Q |
19 |
ttcgccgcaagaaactcgctttaacttcaaagaaacctggtctcttattattattactcacttttcttcac |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50686343 |
ttcgccgcaagaaactcgctttaacttcaaagaaacctggtctcttattattattacacacttttcttcac |
50686273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University