View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_54 (Length: 306)
Name: NF8061_low_54
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 29 - 291
Target Start/End: Original strand, 42897088 - 42897350
Alignment:
| Q |
29 |
atctactagaacaattatttcaaaaactattcatgagttttatatcaatttgttctgttcattctctcactactcaatggttttgtctgtgataaagtcc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897088 |
atctactagaacaattatttcaaaaactattcatgagttttatatcaatttgttctgttcattctctcactactcaatggttttgtctgtgataaagtcc |
42897187 |
T |
 |
| Q |
129 |
acnnnnnnnnnnnnnnnnnnnngggttagacttgtctgcagatcccagaaaaagcaagacttgtaatataacaagaaacattagatccatggaacatgtt |
228 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42897188 |
actttttttccttttttgttttgggttagacttgtctgcagatcctagaaaaagcaagacttgtaatataacaagaaacattagatccatggaatatgtt |
42897287 |
T |
 |
| Q |
229 |
ataacagtcttaggattcaaaatacttcaaacataagnnnnnnncatgatcaaaggtttttat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42897288 |
ataacagtcttaggattcaaaatacttcaaacataagaaaaaaacatgatcaaaggtttttat |
42897350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University