View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_58 (Length: 286)
Name: NF8061_low_58
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 270
Target Start/End: Original strand, 40888637 - 40888888
Alignment:
| Q |
19 |
atgacacactgaccaaccatgctggttgccccattttgtacaatagcatctcctgttgaaaacatgaatacataacataagcataaacaaatccactcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40888637 |
atgacacactgaccaaccatgctggttgccccattttgtacaatagcatctcctgttgaaaacatgaatacataacataagcataaacaaatccactcat |
40888736 |
T |
 |
| Q |
119 |
gaatcaactataaaaaacaagtattgcagctaaagaggcagtgcctgagttcaaagtaacgcagtcttcaagcattagaagagcagttagaggattaaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40888737 |
gaatcaactataaaaaacaagtattgcagctaaagaggcagtgcctgagttcaaagtaacgcagtcttcaagcattagaagagcagttagaggattaaca |
40888836 |
T |
 |
| Q |
219 |
gtaattgtagcagcatattccataggcacacccttatttactttgtgccaca |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40888837 |
gtaattgtagcagcatattccataggcacacccttgtttactttgtgccaca |
40888888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University