View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_67 (Length: 262)
Name: NF8061_low_67
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 52826994 - 52826783
Alignment:
| Q |
17 |
agattggactgccctcttcattgtggtggaccatgttactatgattgtcaccatatgtgtaaagctcattgtcgccgacgatgaaattaaatgctcaacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52826994 |
agattggactgccctcttcattgtggtggaccatgttactatgattgtcaccatatgtgtaaagctcattgtcgccgacgatgaaattaaatgctcaacc |
52826895 |
T |
|
| Q |
117 |
at-gccatttcctcttttaggctacagtatgtcnnnnnnnnnnnnnnnnnnnncttgtaccctaggccttttgacatgtcgacaatggtttcattgcata |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52826894 |
atggccatttcctcttttaggctacagtatgtcttttgtttttgtttttgtttcttgtaccctaggccttttgacatgtcgacaatggtttcattgcata |
52826795 |
T |
|
| Q |
216 |
catgtgctaatt |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52826794 |
catgtgctaatt |
52826783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 95
Target Start/End: Complemental strand, 7452837 - 7452762
Alignment:
| Q |
20 |
ttggactgccctcttcattgtggtggaccatgttactatgattgtcaccatatgtgtaaagctcattgtcgccgac |
95 |
Q |
| |
|
||||| || |||||||| ||||||||||| |||| |||||| || |||||||||| |||||||||||||| |||| |
|
|
| T |
7452837 |
ttggattgtcctcttcactgtggtggaccttgtttctatgactgctaccatatgtgcaaagctcattgtcgacgac |
7452762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University