View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_68 (Length: 259)
Name: NF8061_low_68
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 30872186 - 30872431
Alignment:
| Q |
1 |
acaatcagggtagactaaagattggttttgaatgctatccaactccttataaacttctgactccaaaatctcttttgtcatttccctccaaggtatgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30872186 |
acaatcagggtagactaaagattggttttgaatgctatccaactccttataaacttgtgactccaaaatctcttttgtcatttccctccaaggtatgttg |
30872285 |
T |
 |
| Q |
101 |
tttttctcagctgtactgcatttacaatcacatccaaaactatagttatgcaaaatttgaagc-----aaagtgagtagaagcaatggttaaccaacctt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30872286 |
tttttctcagctgtactgcatttacaatcacatccaaaactatagttatgcaaaatttgaagcaaattaaagtgagtagaagcaatggttaaccaacctt |
30872385 |
T |
 |
| Q |
196 |
ataaaaacttgtctagcaccaagcttgaggatagagtataaaggct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30872386 |
ataaaaacttgtctagcaccaagcttgaggatagagtataaaggct |
30872431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University