View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_75 (Length: 241)
Name: NF8061_low_75
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 19400435 - 19400649
Alignment:
| Q |
13 |
aatatagattagaattcaaatgtgactcaatcatgacaaccaatattgtattagtgttcaagtattctctacctttaagacaaaatttcaactaactata |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
19400435 |
aatatagattagaatttaaatgtgactcaatcatggcaaccaatattgtattagtgttcaagtattctccatctttcagacaaaatttcaactaactata |
19400534 |
T |
|
| Q |
113 |
atatgtatttccaatca---aataaccaacatccctagtttttgttatgctttaataaatatattatgcacattgccaagttttacgacaattttcatat |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19400535 |
atatgtatttccaatcaaataataaccaacatccttaatttttgttatgctttaataaatatattatgcacattgccaagttttacgacaattttcatat |
19400634 |
T |
|
| Q |
210 |
ttttaattgcctttt |
224 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
19400635 |
ttttaattgtctttt |
19400649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 26 - 72
Target Start/End: Original strand, 26630594 - 26630640
Alignment:
| Q |
26 |
attcaaatgtgactcaatcatgacaaccaatattgtattagtgttca |
72 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
26630594 |
attcaaatgtgactcaatcatggcaaccaatattgtaatagttttca |
26630640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University