View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_79 (Length: 232)
Name: NF8061_low_79
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 21721509 - 21721317
Alignment:
| Q |
16 |
aatatatcttcttatttggacacaaattatcttccaatagc-ttcttgcccttttgactattaattaacttgtctaatgtctacctaatttttattcaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21721509 |
aatatatcttcttatttggacacaaattatcttccaattgccttcttgcccttttgactattaattaacttgtctaatgtctacctaatttttattcaaa |
21721410 |
T |
 |
| Q |
115 |
atttctcatgcaagtgtttcttctgcgtgctagctagttttattttcttatcaaaattgcttcctctaactatactataccagaagtaaggat |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21721409 |
atttctcatgcaagtgtttcttctgcgggctagctagttttattttcttatgaaaattgcttcctctaactatactataccagaagtaaggat |
21721317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University