View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_81 (Length: 231)
Name: NF8061_low_81
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_81 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 26 - 216
Target Start/End: Complemental strand, 36182283 - 36182093
Alignment:
| Q |
26 |
catagacagtatagtcgttgcttatggtaaaggaaaattaacaagcttcatggctgatctcgacgcagttttcgacgtggtgagtcaccaaataaaaatt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
36182283 |
catagacagtatagtcgttgcttatggtaaaggaaaattaacaagcttcatggcggatctcgatgcagttttcgacgtggtgagtcaccaaataaatttt |
36182184 |
T |
 |
| Q |
126 |
ttcttgtttttgatcaattccacaaaatgatgcattagttaatattgatgttgaattttgagcagataccagcagacatggtggtaaatgc |
216 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36182183 |
ttcctgtttttgatcaattccacaaaatgatgcattagttaatattgatgttgaattttgagcagataccagcagacatggtggtaaatgc |
36182093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 74
Target Start/End: Original strand, 19505929 - 19505977
Alignment:
| Q |
26 |
catagacagtatagtcgttgcttatggtaaaggaaaattaacaagcttc |
74 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||||||||| ||||| |
|
|
| T |
19505929 |
catagacagtttaattgttgcttatggtaaaggaaaattaacatgcttc |
19505977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University