View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8061_low_83 (Length: 229)
Name: NF8061_low_83
Description: NF8061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8061_low_83 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 45713072 - 45712871
Alignment:
| Q |
9 |
cagaacctgtggactcgaaatcctcaattggaacaaacgttacaaaattgcgacaggtgcagcaaaaggactagctttccttcatcacggtttcatacct |
108 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45713072 |
cagaaccgggggactcgaaatcctcaattggaacaaacgttacaaaattgcgacgggtgcagcaaaaggactagctttccttcatcacggtttcatacct |
45712973 |
T |
|
| Q |
109 |
cacatcattcacagggatgttaaagctagcaacattttactaaatgtagattttgagccgaaagtcgccgattttggactagcaagattgatcagtgcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45712972 |
cacatcattcacagggatgttaaagctagcaacattttactaaatgtagattttgagccgaaagtcgccgattttggactagcaagattgatcagtgcat |
45712873 |
T |
|
| Q |
209 |
gt |
210 |
Q |
| |
|
|| |
|
|
| T |
45712872 |
gt |
45712871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University