View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8062_high_8 (Length: 239)
Name: NF8062_high_8
Description: NF8062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8062_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 15963738 - 15963956
Alignment:
| Q |
5 |
gtgtgatgcatttctatcaaaagaaatattgtggaatggatggtaatggttttgtgatatgtagtttagcagcacagcctccaaaccaacatgtaaaaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
15963738 |
gtgtgatgcatttctatcaaaagaaatattgtggaatggatggtaatggttttgtgatatgtagtttagcagtacggcctccaaaccaacatgtcaaaat |
15963837 |
T |
 |
| Q |
105 |
tcattggttaagtaattgttgttgttcaatatttttagcaacctttaacttgaaatgtagattgaagcaggtagattgattaatatcggtttgaatatga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15963838 |
tcattggttaagtaattgttgttgttcaatatttttagcaacctttaacttgaaatgtagattgaagcaggtagattgattaatatcggtttgaatatga |
15963937 |
T |
 |
| Q |
205 |
gaattttgaacaatgaaga |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
15963938 |
gaattttgaacaatgaaga |
15963956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University