View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8062_low_10 (Length: 239)

Name: NF8062_low_10
Description: NF8062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8062_low_10
NF8062_low_10
[»] chr1 (1 HSPs)
chr1 (5-223)||(15963738-15963956)


Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 15963738 - 15963956
Alignment:
5 gtgtgatgcatttctatcaaaagaaatattgtggaatggatggtaatggttttgtgatatgtagtttagcagcacagcctccaaaccaacatgtaaaaat 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||    
15963738 gtgtgatgcatttctatcaaaagaaatattgtggaatggatggtaatggttttgtgatatgtagtttagcagtacggcctccaaaccaacatgtcaaaat 15963837  T
105 tcattggttaagtaattgttgttgttcaatatttttagcaacctttaacttgaaatgtagattgaagcaggtagattgattaatatcggtttgaatatga 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15963838 tcattggttaagtaattgttgttgttcaatatttttagcaacctttaacttgaaatgtagattgaagcaggtagattgattaatatcggtttgaatatga 15963937  T
205 gaattttgaacaatgaaga 223  Q
    |||||||||||||||||||    
15963938 gaattttgaacaatgaaga 15963956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University