View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8063_low_14 (Length: 249)
Name: NF8063_low_14
Description: NF8063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8063_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 44893769 - 44893536
Alignment:
| Q |
1 |
atctcacaccatcaaatgtgtctcgtctcatctttattacttattatactttttcaaacattattttgcgcctttcttaaaagaaatctatatgctccca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44893769 |
atctcacaccatcaaatgtgtctcgtctcatctttattaattattatactttttcaaacattattttgcgcctttcttaaaagaaatctatatgctccca |
44893670 |
T |
|
| Q |
101 |
aatggagagaataccc-acattctaatgttaatgttgagagccggtg---------gtgttcatattttgattcacaaactttcattattgaaggatgaa |
190 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44893669 |
aatggagagaatacccaacattctaatgttaatgttgagagccggtggttagtagtgtgttcatattttgattcacaaactttcattattgaaggatgaa |
44893570 |
T |
|
| Q |
191 |
tgatagtagtcgtttgacacttgcactttgttgttttgtc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44893569 |
------tagtcgtttgacacttgcactttgttgttttgtc |
44893536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University